HighResolution 3D Ultrasound Jawbone Surface Imaging for. Radiography is used in an attempt to supplement the manual probing. Model 5900PR, Olympus NDT. Ferritin as a novel reporter gene for photoacoustic molecular imaging Ha 2. Cytometry Part AMolecular imaging, a combination of molecular cell biology and medical imaging, is a rapidly expanding field combining the disciplines of cell biology, molecular biology, chemistry, pharmacology, genetics, biomedical physics, engineering, and medicine 1. Recently, remarkable advances in molecular cell biology have accelerated the development of molecular imaging techniques to allow the visualization and characterization, and quantify functional biologic processes at the cellular and subcellular level in living subjects, greatly advancing the field beyond the simple anatomic imaging offered by previous imaging techniques 24. Photoacoustic PA imaging techniques 5, 6 for biomedical applications, especially in molecular imaging, have been rapidly developing 79. PA imaging probes using exogenous contrast agents for photoacoustic molecular imaging PMI have been developed, but the field is still in its infancy 8, 1. PMI using gold nanorods GNRs of mutually exclusive wavelength or specific fluorescent dyes have also been used to detect multiple molecular targets simultaneously in vivo 1. I/4108vphdAuL._SR600%2C315_PIWhiteStrip%2CBottomLeft%2C0%2C35_PIAmznPrime%2CBottomLeft%2C0%2C-5_PIStarRatingFOUR%2CBottomLeft%2C360%2C-6_SR600%2C315_ZA(9%20Reviews)%2C445%2C286%2C400%2C400%2Carial%2C12%2C4%2C0%2C0%2C5_SCLZZZZZZZ_.jpg' alt='Olympus 5900Pr Manual' title='Olympus 5900Pr Manual' />Exogenous contrast agents, in the form of magnetic nanoparticles that bind a receptor found on cancer cells, have been used to detect circulating tumor cells CTC using PA imaging in mice 1. Despite these exciting findings, exogenous contrast agents still have limitations. Exogenous contrast agents such as nanoparticles NPs are free to interact with plasma proteins, which can alter surface properties and effect binding 1. HighResolution 3D Ultrasound Jawbone Surface Imaging for. D Ultrasound Jawbone Surface Imaging for Diagnosis. PR, Olympus. Find Ultrasonic PulserReceiver related suppliers. Model 5900PR, OlympusPanametrics, Waltham, MA, an immersion transducer Model V3320, 75 MHz. Alu Tig 6061 Download as PDF File. PR, frequency range 1 kHz 200 MHz. Olympus. An ultrasound study of altered hydration behaviour of proteoglycandegraded. OLYMPUS 5900PR. behaviour of proteoglycandegraded articular cartilage. Moreover, NPs can be engulfed by phagocytic cells and accumulate in the liver, spleen, or lymph 1. This limitation has led to precise and delicate procedures of surface modification for NPs such as dextran coating, to limit nonspecific binding while preserving specific targeting 1. Despite these advances in targeting and masking, exogenous contrast agents are still challenged by potentially low sensitivity and low binding efficacy to target ligands 1. In addition, there are challenges posed by the need for substrates with desirable pharmacokinetics, potential toxicity, and delayed signal changes 2. In the field of molecular imaging, reporter genes are powerful tools for monitoring gene expression that enable researchers to monitor cancer biology, screen drugs, monitor gene therapy, or track the fate of cells 1, 2. Changes in gene expression often forerun anatomic changes during disease progression, and monitoring these changes using endogenous contrast agents might allow detection of events occurring in the initial stages of disease 2. Olympus Mu 1 PartsOlympus Manuals PdfChanges in gene expression and activity can be monitored by assaying for messenger ribonucleic acid m. RNA, protein, or by directly assaying protein activity 2. The best strategy for detection will depend on the gene being monitored and the disease state. Reporter genes such as green fluorescent protein GFP, luciferase, chloramphenicol acetyl transferase CAT, and 1 galactosidase have been widely used to monitor gene expression invitro and in vivo 2. GFP is a fluorescent protein, which is directly detected by fluorescent microscopy and can be used to visualize gene expression as well localize gene expression within living cells 2. Luciferase can be used for bioluminescence imaging both in vitro and in vivo, and it is very sensitive and quantifiable 3. Despite their wide use and theoretical potential of in vivo imaging, both of these reporter genes are challenging to apply in vivo because of strong light scattering, low signal to background ratios, autofluorescence, and poor tissue penetration 3. Much research has focused on overcoming these disadvantages via the development of new optical imaging methods to detect reporter genes or other endogenous contrast agents 3. It has been recently demonstrated that PMI can be used to detect the expression of specific proteins that may be useful candidates for reporter genes with which to image gene expression and biochemical events in vivo 3. Komatsu Owners Manual. Ferritin, one of the major proteins of iron metabolism, has been reported as an endogenous reporter gene for molecular imaging 3. Ferritin is a highly conserved iron storage protein that plays a prominent role in maintaining intracellular iron homeostasis 3. Fascinatingly, it has been reported that iron containing materials can be detected by PA techniques 3. Here, we demonstrate in vitro the feasibility of using ferritin as a novel endogenous reporter gene for PMI, which would be functional in the absence of externally administered contrast agents. MATERIALS AND METHODSCells and Transfection. Human melanoma SK 2. SK MEL 2. 4 cells were obtained from ATCC American Type Culture Collection, Manassas, VA. SK MEL 2. 4 cells were cultured in Eagles minimum essential medium EMEM ATCC, Manassas, VA supplemented with 1. FBS. SK MEL 2. SK MEL 2. Junk Bot Undercover Game here. DNA using lipofectamine 2. Invitrogen Corporation, Carlsbad, CA as per manufacturers instructions. Dj Mix Player Software For Windows 7 on this page. Briefly, 9 l of lipofectamine 2. DNA were mixed in 3 ml EMEM media, which was added to each 6. SK MEL 2. 4 cells and incubated for 46 h, followed by replacement of the media with EMEM containing 1. FBS. SK MEL 2. 4 cells were incubated for 4. PA imaging. SK MEL 2. H FT plasmid, in which the human H FT gene was cloned behind the strong viral CMV promoter of p. CDNA3. 1 Invitrogen, Carlsbad, CA, or p EGPF C1 Clontech, Mountain View, CA, or not transfected. Immunofluorescence. Transfected or nontransfected SK MEL 2. C in blocking media Phosphate buffered saline PBS with 1 bovine serum albumin BSA and 1 horse serum HS. Blocking solution was then removed and SK MEL 2. Iockland, Gilbertsville, PA, at a 1 5,0. C. SK MEL 2. 4 cells were then washed with PBS and fixed in 4 paraformaldehyde for 1. To confirm H FT gene expression from SK MEL 2. X8. 1, Olympus, USA and images were acquired using a CCD camera DP7. Olympus, USA. All images were acquired and processed using identical settings. In addition, we were able to observe a 6. EGPF C1, which expresses GFP as a reporter 3. Quantitative Real time Reverse transcription PCRReal time reverse transcription PCR RT PCR was performed to quantify expression of H FT. Briefly, SK MEL 2. RNA was extracted using TRIzol reagent Invitrogen, Carlsbad, CA as per manufacturers instructions and quantified on a Smart. Spec Plus spectrophotometer Bio Rad, Hercules, CA. Ferritin specific primers were used to amplify the human H FT c. DNA, using the following sequences 5 CATCAACCGGATCAAC 3 forward, 5 GATGGCTTTCACCTGCTCAT 3 reverse. Real time PCR was performed on a ABI Prism 7. Applied Biosystems, Foster City, CA using the Absolute Blue SYBR Green kit Thermo Fischer Scientific, Epsom, Surrey, UK. H FT expression in all samples was calculated by the Ct method as fold over glyceraldehyde 3 phosphate dehydrogenase GAPDH expression as an internal control, and compared to nontransfected SK MEL 2. In Vitro Photoacoustic Imaging. As depicted in Figure 1, a Nd Yag pulsed laser Brilliant, Quantel, France pumps an optical parametric oscillator Vibrant HE5. I, Opo. Tek, Carlsbad, CA to generate 5 ns pulses at 1. Hz. The range of wavelength was tuned from 8. The laser beam was directed to illuminate on the surface of SK MEL 2.